Review



dn 050 peptide  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    R&D Systems dn 050 peptide
    Dn 050 Peptide, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dn+050+peptide/Recombinant+Mouse+DNAM-1%2FCD226+Fc+Chimera+Protein%2C+CF/10__7554_slash_elife__29540-371-28-34
    Average 94 stars, based on 5 article reviews
    dn 050 peptide - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    Sequencing:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    Staining:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    TA Cloning:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    Reverse Transcription:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    SYBR Green Assay:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform

    Polymerase Chain Reaction:

    Article Title: CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells
    Article Snippet: DOI: https://doi.org/10.7554/eLife.29540 19 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information antibody anti-Foxp3 (rat monoclonal) ebioscience RRID:AB_1518812 clone: FJK-16s antibody anti-phospho ZAP70/SykTyr319/Tyr352 (mouse monoclonal) ebioscience RRID:AB_2572664 clone: n3kobu5 antibody anti-phospho ERK1/2Thr202/Tyr204 (mouse monoclonal) BioLegend RRID:AB_2629710 clone: 6B8B69 antibody anti-phospho AKT1Ser473 (mouse monoclonal) ebioscience RRID:AB_2573309 clone: SDRNR antibody anti-phospho S6Ser235, Ser236 (mouse monoclonal) ebioscience RRID:AB_2572666 clone: cupk43k antibody anti-phospho STAT5 (mouse monoclonal) BD Biosciences RRID:AB_10894188 clone: 47/Stat5(pY694) antibody anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal) BD Biosciences RRID:AB_2716578 clone: O72-670 antibody PerCP/Cy5.5-streptavidin BioLegend RRID:AB_2716577 recombinant DNA reagent pCR 2.1-TOPO (vector) Invitrogen CAT#: K204040 sequence-based reagent Foxp3 Intron1 Eton Bioscience Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC sequence-based reagent Foxp3 TSDR Eton Bioscience Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA sequence-based reagent Rara Eton Bioscience Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG sequence-based reagent Rarb Eton Bioscience Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG sequence-based reagent Rarg Eton Bioscience Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG sequence-based reagent Oligo(dT)12-18 Primer Invitrogen CAT#: 18418012 peptide, recombinant protein CRIg-Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated CRIg-Ig this paper prepared by our laboratory peptide, recombinant protein control Ig Genentech PMID: 16530040 peptide, recombinant protein Biotinylated control Ig this paper prepared by our laboratory peptide, recombinant protein CTLA-4 Ig R and D Systems CAT#: 434-CT-200/CF peptide, recombinant protein PD-1 Ig R and D Systems CAT#: 1021-PD-100 peptide, recombinant protein VISTA Ig R and D Systems CAT#: 7005-B7-050 Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 20 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information peptide, recombinant protein CD226 Ig R and D Systems CAT#: 4436-DN-050 peptide, recombinant protein TIGIT Ig R and D Systems CAT#: 7267-TG-050 peptide, recombinant protein BDC2.5 mimotope AnaSpec CAT#: AS-63774 Sequence: RTRPLWVRME peptide, recombinant protein Recombinant Murine IL-2 PeproTech CAT#: 212–12 peptide, recombinant protein Recombinant Human TGF-b1 PeproTech CAT#: 100–21 commercial assay or kit ACK lysing buffer Lonza CAT#: 10-548E commercial assay or kit Anti-PE microBeads Miltenyi Biotec CAT#: 130-048-801 commercial assay or kit LIVE/DEAD fixable dead cell stain kits Invitrogen CAT#: L34972; CAT#: L34966 commercial assay or kit Foxp3/Transcription factor staining buffer set ebioscience CAT#: 00-5523-00 commercial assay or kit Phosflow Lyse/Fix buffer BD Biosciences CAT#: 558049 commercial assay or kit Phosflow Perm buffer III BD Biosciences CAT#: 558050 commercial assay or kit Percoll GE Healthcare Life Science CAT#: 17-0891-01 commercial assay or kit NucleoSpin Tissue XS Macherey-Nagel CAT#: 740901.50 commercial assay or kit EZ DNA Methylaiton Kit Zymo Research CAT#: D5001 commercial assay or kit HotStarTaq DNA Polymerase QIAGEN CAT#: 203203 commercial assay or kit TOPO TA Cloning Kit Invitrogen CAT#: K204040 commercial assay or kit TRIzol Reagent Invitrogen CAT#: 15596026 commercial assay or kit SuperScript III Reverse Transcriptase Invitrogen CAT#: 18080044 commercial assay or kit SYBR Green PCR Master Mix Applied Biosystems CAT#: 4309155 chemical compound, drug Collagenase P Roche CAT#: 11249002001 chemical compound, drug Collagenase D Roche CAT#: 11088882001 chemical compound, drug DNase I Sigma-Aldrich CAT#: DN25-1G chemical compound, drug ATRA Sigma-Aldrich CAT#: R2625-50MG chemical compound, drug BMS 493 Sigma-Aldrich CAT#: B6688-5MG Continued on next page Yuan et al. eLife 2017;6:e29540. .. DOI: https://doi.org/10.7554/eLife.29540 21 of 29 Continued Reagent type (species) or resources Designation Source or reference Identifiers Additional information chemical compound, drug Vancomycin Acros Organics CAT#: 296990010 chemical compound, drug Metronidazole Acros Organics CAT#: 210340050 chemical compound, drug Neomycin Fisher Scientific CAT#: BP266925 chemical compound, drug Ampicillin Sigma-Aldrich CAT#: A0166-25G chemical compound, drug PMA Sigma-Aldrich CAT#: P1585-1MG chemical compound, drug Ionomycin Sigma-Aldrich CAT#: I0634-1MG chemical compound, drug Brefeldin A solution BioLegend CAT#: 420601 chemical compound, drug Fisher Healthcare Tissue-Plus O.C.T Compound Fisher Scientific CAT#: 23-730-571 chemical compound, drug Avidin, HRP conjugate Invitrogen CAT#: 434423 chemical compound, drug 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific CAT#: 34028 chemical compound, drug Stop Solution for TMB Substrates Thermo Scientific CAT#: N600 chemical compound, drug DAPI Invitrogen CAT#: D1306 software, algorithm FlowJo FlowJo, LLC RRID:SCR_008520 software, algorithm ImageJ NIH RRID:SCR_003070 software, algorithm BISMA software other RRID:SCR_000688 public website, BDPC DNA methylation analysis platform



    Similar Products

    dn 050 peptide  (R&D Systems)
    94
    R&D Systems dn 050 peptide
    Dn 050 Peptide, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dn+050+peptide/Recombinant+Mouse+DNAM-1%2FCD226+Fc+Chimera+Protein%2C+CF/10__7554_slash_elife__29540-371-28-34
    Average 94 stars, based on 1 article reviews
    dn 050 peptide - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results